An SP1-like cis-element is the major DNA motif for differential expression regulation of the adipocyte amino acid transporter.

Adipocyte amino acid transporter (AAAT) is induced during the 3T3-L1 preadipocyte differentiation process. In the -1819-bp 5'-upstream flanking region of the AAAT genomic gene, six DNase I protected sites were identified by using the 3T3-L1 adipocyte nuclear extract. Results of chloramphenicol acetyltransferase (CAT) expression from the chimeric AAAT promoter-driven CAT reporter gene indicated that one protein binding site, from -68 to -26, was essential for the promoter activity. However, this protein binding site does not contain recognition sites of the transcription factors important for adipocyte differentiation, i.e., the C/EBP or PPAR family. Further analysis revealed that the DNA sequence, TTCAAGTCCCGCCCTCCGCT from -65 to -46, was the cis-element essential and partially sufficient for inducible activity of the AAAT gene promoter.