The triplex-hairpin transition in cytosine-rich DNA.

We present a theoretical study of the self-complementary single-stranded 30-mer d(TCTTCCTTTTCCTTCTCCCGAGAAGGTTTT) (PDB ID: 1b4y) that was designed to form an intramolecular triplex by folding back twice on itself. At neutral pH the molecule exists in a duplex hairpin conformation, whereas at acidic pH the cytosines labeled by an asterisk (*) are protonated, forming Hoogsteen hydrogen bonds with guanine of a GC Watson-Crick basepair to generate a triplex. As a first step in an investigation of the energetics of the triplex-hairpin transition, we applied the Bashford-Karplus multiple site model of protonation to calculate the titration curves for the two conformations. Based on these data, a two-state model is used to study the equilibrium properties of transition. Although this model properly describes the thermodynamics of the protonation-deprotonation steps that drive the folding-unfolding of the oligomer, it cannot provide insight into the time-dependent mechanism of the process. A series of molecular dynamics simulations using the ff94 force field of the AMBER 6.0 package was therefore run to explore the dynamics of the folding/unfolding pathway. The molecular dynamics method was combined with Poisson-Boltzmann calculations to determine when a change in protonation state was warranted during a trajectory. This revealed a sequence of elementary protonation steps during the folding/unfolding transition and suggests a strong coupling between ionization and folding in cytosine-rich triple-helical triplexes.