DNA covalent immobilization onto screen-printed electrode networks for direct label-free hybridization detection of p53 sequences.

A new electrochemical biochip for the detection of DNA sequences was developed. The entire biochip-i.e., working, reference, and counter electrodes-was constructed based on the screen-printing technique and exhibits eight working electrodes that could be individually addressed and grafted through a simple electrochemical procedure. Screen-printed electrode networks were functionalized electrochemically with 1-ethyl-3-(3dimethylaminopropyl)carbodidiimide according to a simple procedure. Single-stranded DNA with a C6-NH(2) linker at the 5'-end was then covalently bound to the surface to act as probe for the direct, nonlabeled, detection of complementary strands in a conductive liquid medium. In the present system, the study was focused on a particular codon (273) localized in the exon 8 of the p53 gene (20 mer, TTGAGGTGCATGTTTGTGCC). The integrity of the immobilized probes and its ability to capture target sequences was monitored through chemiluminescent detection following the hybridization of a peroxidase-labeled target. The grafting of the probe at the electrode surface was shown to generate significant shifts of the Nyquist curves measured in the 10-kHz to 80-Hz range. These variations of the faradaic impedance were found to be related to changes of the double layer capacitance of the electrochemical system's equivalent circuit. Similarly, hybridization of complementary strands was monitored through the measurements of these shifts, which enabled the detection of target sequences from 1 to 200 nM. Discrimination between complementary, noncomplementary, and single-nucleotide mismatch targets was easily accomplished.