[Procedure for identification of G1 genotype in Echinococcus granulosus isolates].

This study was undertaken to analyze the nucleotide sequences of a marker fragment in the mitochondrial cox1 gene in polymorphic variants of G1 strain from the nucleotide sequence bank "Genbank" and to choose conditions for a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method to differentiate the G1 genotype in E.granulosus isolates. The analysis indicated that G1 genotype polymorphism was due to impact nucleotide replacements and to the varying length of the marker fragment of the coxl gene (by the presence of absence of the 5' GTGGCT 3' site with the coordinates 10275-10280). The procedure of PCR-RFLP was modified to identify the G1 variants due to the varying coxl length. New primers annealed to the variable coxl site of the following structure: 5' TGTGTTGATTTT-GCCTGG 3' (direct); 5' GCCACCACAAACCAAGTATC 3' (inverse) were chosen. Then the localizations of restriction sites were determined for the endonucleases R.Fok 1, R.Sfa NI, and R.Mael and the restriction fragment length was calculated for the RFLP analysis.