First Report of Carrot red leaf virus and Carrot mottle virus, Causal Agents of Carrot Motley Dwarf, in Carrot in Mauritius.

Carrot motley dwarf (CMD) affects carrot and other apiaceous plants by causing leaf yellowing or reddening as well as plant stunting and leads often to serious economic losses wherever these crops are grown (2). CMD has been reported from Australia, Europe, Japan, Israel, and North America and is known to result from a mixed infection by at least two viruses, the polerovirus, Carrot red leaf virus (CtRLV), and one of the umbraviruses, Carrot mottle virus (CMoV) or Carrot mottle mimic virus (CMoMV). The viruses are transmitted in a circulative persistent manner by aphid species (Cavariella spp.). In November of 2008, symptoms typical of CMD were observed in carrot (Daucus carota) and coriander (Coriandrum sativum) plantations in the region of Henrietta in the central part of Mauritius. Carrot cultivars affected were Victoria, Sigma, and Namdhari. Incidences of up to 50% were recorded in some fields. Symptoms were observed mainly on plants near the edges of fields and were initially attributed to physiological factors. However, following RNA extraction from affected carrot plants and reverse transcription (RT)-PCR, fragments of the expected sizes (CtRLV; 377 bp: CMoV; 549 bp) were obtained. For CtRLV, a pair of degenerate primers (S2/AS3 [1]) for poleroviruses, and for the above mentioned umbraviruses, a universal primer pair (UmbraCS: CTTTGGAGTACACAACAACTCC and UmbraCAS: GCA/GTCIAGICCIACACAA/GACTGG, I = Inosin; unpublished) was used. Direct sequencing of one PCR product for each virus (Eurofins MWG Operon GmbH, Martinsried, Germany) and comparison with sequences retrieved from GenBank resulted in nucleotide and amino acid sequence identities of 93 and 90% (coat protein) to the CtRLV strain UK-1 (Accession No. AY695933) and 86 and 96% (replicase) to the German CMoV isolate (Accession No. FJ188473), respectively. Carrot samples also tested CtRLV-positive in triple-antibody sandwich-ELISA using polyclonal IgGs to CtRLV for trapping and a mixture of two CtRLV-specific monoclonal antibodies (CtRLV-2-3A9 and CtRLV 3-4B9) as detecting antibodies (all from the stock of the Julius Kuehn Institute; H. J. Vetten, Braunschweig, Germany). The presence of CMoV was confirmed by sap transmission to Nicotiana benthamiana and N. occidentalis 'P1', which resulted in vein yellowing/etching symptoms. In addition, agarose gel electrophoresis of the dsRNA extract of a primary infected carrot sample revealed major dsRNAs of approximately 4.2 and 1.4 kbp, which represent the genomic and subgenomic RNAs of an umbravirus. Thus, sequence analysis, as well as serological and biological data, demonstrates that CMD-affected carrot plants from Mauritius were infected with CtRLV and CMoV isolates closely related to those from Europe. The sequences obtained in this study for CtRLV and CMoV have been deposited in GenBank under Accession Nos. FJ969849 and FJ969848, respectively. To our knowledge, this is the first report of CMD in Mauritius and the Indian Ocean Region. Future works comprise an island wide survey across carrot-growing regions to determine the incidence of the virus complex and the natural host range of the viruses in Mauritius. References: (1) A. D. Abraham et al. Plant Dis. 91:1059, 2007. (2) A. F. Murant. No 137 in: Descriptions of Plant Viruses. Assoc. Appl. Biol. Kew, England, 1974.