Characterization of kdgR, a gene of Erwinia chrysanthemi that regulates pectin degradation.

Erwinia chrysanthemi is a phytopathogenic enterobacterium able to degrade the pectic fraction of plant cell walls. The kdgR negative regulatory gene controls all the genes involved in pectin catabolism, including the pel genes encoding pectate lyases. The E. chrysanthemi kdgR regulatory gene was subcloned in Escherichia coli where it was shown to be functional, since it repressed the expression of a pelE::uidA fusion. The nucleotide sequence of kdgR contained an open reading frame of 918bp preceded by classical transcriptional initiation signals. KdgR shows similarity to two other regulatory proteins, namely GylR, encoding an activator protein of the glycerol operon in Streptomyces coelicolor, and IclR, encoding a repressor of the acetate operon in Salmonella typhimurium and in Escherichia coli. Previously, comparison of regulatory regions of several genes controlled by kdgR revealed the existence of a conserved region which was proposed as a KdgR-binding site. The 25 bp oligonucleotide AAAAAAGAAACATTGTTTCATTTGT corresponding to this consensus was substituted to the lac operator, at the beginning of transcription of the lacZ gene. This construct functioned as an operator for binding of the KdgR protein in vivo.