Sequences near the origin of replication of the DHFR locus of Chinese hamster ovary cells adopt left-handed Z-DNA and triplex structures.

The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in negatively supercoiled plasmids at pH 5.2 (Caddle, M. S., Lussier, R. L., and Heintz, N. H. (1990) J. Mol. Biol. 211, 19-33). To further characterize the structural organization, supercoiled plasmids containing this region were analyzed in vitro with OsO4 and diethyl pyrocarbonate probes as well as with two-dimensional gel electrophoresis under different conditions. In pMCG, which contains the sequence in a 1.6-kilobase pair insert, the preferred conformation at neutral pH and at the native superhelical density is a Z-DNA structure for the (GC)5(AC)18 tract. Under mildly acidic conditions and at the native superhelical density, both (AG) tracts form intramolecular triplexes to the exclusion of the Z-DNA structure. Chemical probing of topoisomers of pMCG indicates that the (AG)27 tract forms a triplex more readily than the (AG)21 motif. Also, analysis of the reactivity obtained on a larger plasmid, pMCD, which contains the cluster of repeated sequences in a 4.75-kilobase pair insert, shows that at the native superhelical density the formation of intramolecular triplexes is limited to the (AG)27 tract. Finally, experiments conducted on different populations of topoisomers of pMCG show the existence, at pH 5.0 and highly negative superhelical density (greater than or equal to 0.080), of both the left-handed and the two triple-stranded structures in the same DNA. Therefore, one triplex is located immediately adjacent to the Z helix. Companion studies revealed that this region of the DHFR replicon modulates fork translocation during the replication of recombinant plasmids in mammalian cells.