Increased Flexibility between Stems of Intramolecular Three-Way Junctions by the Insertion of Bulges.

Intramolecular junctions are a ubiquitous structure within DNA and RNA; three-way junctions in particular have high strain around the junction because of the lack of flexibility, preventing the junctions from adopting conformations that would allow for optimal folding. In this work, we used a combination of calorimetric and spectroscopic techniques to study the unfolding of four intramolecular three-way junctions. The control three-way junction, 3H, has the sequence d(GAAATTGCGCTGCGCGTGCTGCACAATTTC), which has three arms of different sequences. We studied three other three-way junctions in which one (2HSH), two (HS2HS), and three (HSHSHS) cytosine bulges were placed at the junction to allow the arms to adopt a wider range of conformations that may potentially relieve strain. Through calorimetric studies, it was concluded that bulges produce only minor effects on the enthalpic and thermal stability at physiological salt concentrations for 2HSH and HSHSHS. HS2HS displays the strongest effect, with the GTGC stem lacking a defined transition. In addition to unfolding thermodynamics, the differential binding of counterions, water, and protons was determined. It was found that with each bulge, there was a large increase in the binding of counterions; this correlated with a decrease in the immobilization of structural water molecules. The increase in counterion uptake upon folding likely displaces binding of structural water, which is measured by the osmotic stress method, in favor of electrostricted waters. The cytosine bulges do not affect the binding of protons; this finding indicates that the bulges are not forming base-triplet stacks. These results indicate that bulges in junctions do not affect the unfolding profile or the enthalpy of oligonucleotides but do affect the number and amount of molecules immobilized by the junction.