First Report of Blueberry Mosaic Disease Caused by Blueberry mosaic associated virus in Kentucky.

In 2011, a grower in Casey County, Kentucky, observed persistent yellow, green, and red mosaic patterns on leaves of highbush blueberry plants. Twenty-three randomly-scattered cv. Bluecrop plants out of approximately 1,400 5-year-old plants showed symptoms, with coverage on each plant ranging from 5 to 100%. Asymptomatic canes bloomed normally and produced fruit; affected canes were stunted and did not bloom. These symptoms are generally consistent with those described for blueberry mosaic disease (BMD) (1,3), the casual agent of which is Blueberry mosaic associated virus (BlMaV) (4). All plants were purchased from a local nursery, but their origin was unknown. In 2012, leaves from each of five symptomatic plants were tested by reverse transcription-polymerase chain reaction (RT-PCR) for BlMaV. Total nucleic acid was isolated from the symptomatic leaves, and asymptomatic leaves of randomly selected healthy plants served as negative controls. The CTAB method was used as described (2), and RNA was isolated using lithium chloride. cDNA was synthesized using the SuperScript VILO cDNA synthesis kit (Invitrogen, Carlsbad, CA). Two different primer sets were used for detection of BlMaV; BlMaVCP5'-1F (GGTTGATGGATGCTTACGAA) and BlMaVRNA3-1378R (CTTCACTTACCACATTATACATCTC) to amplify a 1,370-bp portion of RNA3 and RNA2-2F (TTCGATCCCAGCCCTCTCCC) and RNA2-2R (AGGCAAAGGGAAAGAAATTCAGGTGTC) to amplify a 1,281-bp portion of RNA2. All symptomatic samples tested by RT-PCR yielded a fragment for each primer set, and the amplicon sizes were as expected. No fragments were amplified from the negative controls. To further confirm diagnosis, the primer sets noted above were used to re-amplify the same two fragments from each of three of the samples. These fragments were cloned and sequenced on the CEQ8000 (Beckman-Coulter, Brea, CA) using the GenomeLab DTCS Quick Start sequencing kit (Beckman-Coulter) and the universal M13 forward and reverse primers as well as internal primers: BlMaV-CP Int 1F (ACAATTAAGAAGTCCTCGTAT), BlMaV-CP Int 2F (ATGTCCGGATGCTAGTCGCT), and BlMaV RNA2 IntR (GGTGGGGACGGAATAATACAGAG). All sequences were consistent with those now published for BlMaV, with 98% identity at the nucleic acid level for both fragments. In 2013, the grower removed plants with more than 50% symptomatic tissue, and no newly symptomatic plants were observed that year. Sixteen remaining symptomatic plants, as well as 36 asymptomatic plants adjacent to those with symptoms, were sampled and tested by RT-PCR. All symptomatic plants were confirmed to be infected with BlMaV, as well as 30 of the 36 asymptomatic plants. It has been suggested that newly infected plants may take a year to express symptoms (5), which may explain the finding of 30 infected but asymptomatic plants. This is the first report of an association of BIMaV with BMD in Kentucky. These results indicate that BMD can establish in Kentucky blueberry fields. References: (1) R. R. Martin et al. Viruses 4:2831-2852, 2012. (2) J. J. Polashock et al. Plant Pathol. 58:1116, 2009. (3) D. C. Ramsdell. In: Compendium of Blueberry and Cranberry Diseases. APS Press, St. Paul, MN, 1995. (4) T. Thekke-Veetil et al. Virus Res. 189:92, 2014. (5) E. H. Varney. Phytopathology 47:307, 1957.