First Report of Rosa multiflora cryptic virus in Rosa multiflora in the Eastern United States.

In the process of attempting to identify the rose rosette agent, double-stranded RNA was isolated from several symptomatic Rosa multiflora plants from northwestern Arkansas. The pattern of the dsRNA bands differed among the five samples used in this study, suggesting the presence of several viruses. Four of the five plants tested had two predominant bands of approximately 1.8 and 1.5 kbp, a pattern similar to that observed in plants infected with Fragaria chiloensis cryptic virus (FCCV; 3), and further steps were taken for the identification of the putative virus. One plant that only had the two predominant bands was chosen for further characterization using degenerate oligonucleotide primed (DOP)-PCR (4). Twenty clones were sequenced and all were found to be part of two contigs of 937 and 1,087 nucleotides that have been deposited in GenBank (Accession nos. EU350962 and EU350963). The two contigs had 82 and 72% nucleotide and 85 and 69% amino acid sequence identities with RNA 1 and 2 of FCCV, respectively; 98 and 99% amino acid sequence identities with Rose multiflora cryptic virus (RMCV; 2) RNA 1 and 3, respectively. Oligonucleotide primers F (5' gaatgggaactacgctttgc 3') and R (5' cgatgcttccaatgatgttg 3') designed to amplify a 196-bp region of RNA 1 of the virus were tested using ss and dsRNA templates and were shown to be virus specific after sequencing of multiple PCR amplicons. Just before submission of this manuscript, the complete sequence of RMCV, a virus isolated from R. multiflora showing rose spring dwarf symptoms was published (2). RMCV and the dsRNAs isolated from R. multiflora in Arkansas are the same species because they share 99% nucleotide sequence identity. Cryptic viruses are expected to be symptomless though mild symptoms have been associated with several cryptic viruses (1). The presence of RMCV has been verified in both symptomless and plants infected with two severe diseases of rose, thus, the virus could play a role in the phenotype of these diseases as part of a virus complex. To our knowledge, this is the first report of RMCV in the eastern United States, which is closley related to RMCV from California (2). In the review process of this note, it was brought to our attention that a similar virus named Rose cryptic virus 1 was being investigated in Mississippi (Genbank Accession Nos. EU413666-68), supporting the statement that this virus is probably widespread in Rosa germplasm. References: (1) L. Chen et al. Arch. Virol. 151:849, 2006. (2) N. M. Salem et al. Arch. Virol. 153:455, 2008. (3) I. E. Tzanetakis et al. Virus Genes 36:267, 2008. (4) I. E. Tzanetakis and R. R. Martin. J. Virol. Methods 149:167, 2008.