First report of pepino mosaic virus infecting tomato in South Korea.

Pepino mosaic virus (PepMV), a member of the genus in the family , has been responsible for economic losses in tomato across Africa, Asia, Europe, and the Americas over the last two decades, but has not previously been reported in South Korea. In December 2020, virus-like symptoms (foliar interveinal chlorosis and unevenly discolored fruits) were observed on ~5% of tomato () plants growing in a greenhouse in Jeolla province, South Korea. To identify the causal virus, total RNA from a leaf sample of the symptomatic tomato was extracted using an RNeasy Plant Mini Kit (Qiagen, Germany) and analyzed by high-throughput sequencing. Ribosomal RNA was removed and a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA LT Sample Prep Kit (Plants) and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea), yielding 151 nt paired end reads. assembly of the 74,417,192 reads was performed using Trinity software (r20140717) while the 308,940 initially assembled contigs were screened against the NCBI viral genome database using BLASTN. Two contigs of 6,419 and 6,391 bp (GenBank LC656469, JKT1; and LC656470, JKT2) shared 94.81% and 98.34% nucleotide (nt) identities with isolates of the CH2 group (MK133092 and MF422613) and US1 group (FJ940225), respectively. No contigs representing other plant viruses were identified. A phylogenetic tree of the genomes of 44 isolates encompassing different PepMV strains (Abrahamian et al., 2020) also placed JKT1 in the CH2 clade, and JKT2 in the US1 clade. Leaf samples from 24 randomly selected plants from the same greenhouse were tested by reverse transcription-polymerase chain reaction (RT-PCR) with PepMV-specific primers, Pep3/Pep4 and PepCP-D/PepCP-R (Souiri et al., 2019), yielding products of the expected sizes (625 bp for Pep3/Pep4 and 848 bp for PepCP-D/PepCP-R) from all samples. Amplicons were cloned into the pGEM-T Easy Vector (Promega, USA); two clones for each amplicon were bidirectionally sequenced (BIONEER, Korea) and deposited in GenBank. The 848 bp amplicon (accession no. LC637517) showed 99.65% nt identity to the JKT1 genome (LC656469) and 94.69% identity to a CH2 isolate (JN835466); the 625 bp amplicon (LC637518) had 99.36% nt identity to the JKT2 genome (LC656470) and 97.28% identity to a US1 isolate (FJ940225). Primers specific to the coat protein gene of each isolate (JKT1-F/JKT1-R, CGCTTGCTGGTGCTGTTCAAG/ACGTCTAGACAAAGCAGGGTT, 934 bp; JKT2-F/JKT2-R, CACTAAATGCAGCAGTTTCTG/AGTTTCATTAGCAGCCAGTC, 830 bp) also yielded the expected amplicons from all 24 samples, indicating mixed infections of PepMV strains CH2 and US1. The PCR products from three randomly-selected samples shared 79.93-80.17% nt identity between (JKT1/JKT2) two JKT1-derived sequences (LC683791 and LC683792) and two JKT2-derived sequences (LC683793 and LC683794), further supporting the presence of mixed infections in the samples. To our knowledge, this is the first report of PepMV infecting tomato in South Korea. The virus is carried on tomato seeds (Córdoba-Sellés et al., 2007; Hanssen et al., 2010), and efficiently transmitted by mechanical means leading to rapid spread in tomato crops, and the severe strain CH2 may be a serious threat to tomato production in South Korea. It is important to concentrate on the phytosanitary control for both importation and exportation to manage and prevent further spread of contaminated seeds or infected transplants.