Progranulin Gene Mutations in Chinese Patients with Frontotemporal Dementia: A Case Report and Literature Review.

BACKGROUND

Progranulin (GRN) mutations in frontotemporal dementia (FTD) have been less frequently reported in China than in Western countries.

OBJECTIVE

This study reports a novel GRN mutation and summarizes the genetic and clinical features of patients with GRN mutations in China.

METHODS

Comprehensive clinical, genetic, and neuroimaging examinations were conducted on a 58-year-old female patient diagnosed with semantic variant primary progressive aphasia. A literature review was also conducted and clinical and genetic features of patients with GRN mutations in China were summarized.

RESULTS

Neuroimaging revealed marked lateral atrophy and hypometabolism in the left frontal, temporal, and parietal lobes. The patient was negative for pathologic amyloid and tau deposition by positron emission tomography. A novel heterozygous 45-bp deletion (c.1414-14_1444delCCCTTCCCCGCCAGGCTGTGTGCTGCGAGGATCGCCAGCACTGCT) was detected by whole-exome sequencing of the patient's genomic DNA. Nonsense-mediated mRNA decay was presumed to be involved in the degradation of the mutant gene transcript. The mutation was deemed pathogenic according to American College of Medical Genetics and Genomics criteria. The patient had a reduced plasma GRN level. In the literature, there were reports of 13 Chinese patients - mostly female - with GRN mutations; the prevalence was 1.2% -2.6% and patients mostly had early disease onset.

CONCLUSION

Our findings expand the mutation profile of GRN in China, which can aid the diagnosis and treatment of FTD.