[Amplified 23S rRNA gene of 52 strains of Leptospira and detection of leptospiral DNA in 55 patients by PCR].

Based upon the polymerase chain reaction (PCR), We have developed a sensitive assay for Leptospira interrogans, the agent of leptospirosis. DNA amplification was carried out using primer A: 5'GATCTAATTCGCTGTAGCAGG3' and primer B: 5'ACTTTCACCCTCTATGGTCGG3'. After 30 cycles of amplification, the product could be detected by agarose gel electrophoresis. A segment (124 bp) was amplified in all strains of L. interrogans including 20 Serogroups, 49 Serovars tested, but it was not detected in Patoc I strain, Serovar patoc of Leptospira biflexa and 3055 strain of Leptonema illini (both of which are nonpathogenic). All of the serum (first time) which proved either by blood culture or MAT showed that positive rates were 100%. Leptospiral infection in humans and some domestic animals leads to one or more of a variety of manifestation and persists through a considerable duration of time. However it is relatively difficult to demonstrate the presence of leptospires in serum. The serum (second time) obtained from 55 patients with leptospirosis (6-60 days after on set) showed that PCR positive rates were 74.55% (41/55). The PCR positive rates for healthy subjects were 15% (3/20), P < 0.001. The diagnosis of leptospirosis by using PCR may become a significant addition to the routine laboratory diagnosis and a valuable technique for the investigation of leptospirosis pathogenesis.