Interaction of organophosphorus insecticide methylparathion with calf thymus DNA and a synthetic DNA duplex.

The interaction of an organophosphorus insecticide methylparathion (O,O-dimethyl O-4-nitrophenyl phosphorothioate) with double-stranded DNA was characterized by UV and circular dichroism (CD) spectroscopy. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and a synthetic two-stranded oligomer of sequence 5'-d(TTGGATCCGAATTCAAGCTT)-3'. Melting curves and CD spectra were taken for the DNAs in the presence of the insecticide at methylparathion/DNA base pair molar ratio of 0.5. The insecticide evoked a decrease of the melting temperature and a broadening of the transition range for CT DNA. Similar effects were observed for the synthetic oligomer but they were less pronounced than in the case of CT DNA. Methylparathion evoked a slight shift and an increase in the amplitude of the negative band in the CD spectra of both DNAs. Obtained results indicate that methylparathion may perturb the thermal stability and conformation of DNA, which is an evidence that the insecticide has an ability to interact directly with DNA.