Gene structure of the rat kainate receptor subunit KA2 and characterization of an intronic negative regulatory region.

We have isolated and analyzed the structure of the gene grik5 (glutamate receptor ionotropic kainate 5), encoding the rat kainate receptor subunit KA2. Six overlapping DNA fragments containing the entire grik5 gene were identified in a rat genomic library. grik5 is a unique gene composed of 20 exons that together span over 54 kilobases (kb). Reporter gene analysis demonstrated that 2 kb of grik5 5'-flanking sequence confers tissue-specific expression on a chloramphenicol acetyltransferase gene in vitro. We show that (i) the first intron of grik5 (3.4 kb) inhibited transcription of the chloramphenicol acetyltransferase gene driven by the 2-kb grik5 5'-flanking region; (ii) the negative regulatory element was located within 500 bp of the 3'-end of intron 1, and this 500-bp fragment selectively bound nuclear proteins isolated from neural and nonneural cells; (iii) the effect of the negative regulatory element on grik5 transcription was orientation- and distance-independent; and (iv) a 24-nucleotide sequence (CTTTCTGTGGCCTCTGACCTTTCC) was identified as the binding site for nuclear proteins within the 500-bp fragment, as determined by footprinting and gel shift assays. We conclude that an intronic element that displays features of a silencer modulates grik5 transcription.