Pathogenic Mutations in Chinese Han Families With Hypohidrotic Ectodermal Dysplasia and Genotype-Phenotype: A Correlation Analysis.

BACKGROUND

This study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients.

METHODS

Whole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. - and Fisher's tests were used to analyze the genotype-phenotype correlations.

RESULTS

(1) WES identified missense mutations [c.1127 C > T (p.T376M; NM_001005609)] in family 1 and an nonframeshift deletion mutation [c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609)] in family 2. Sanger sequencing validated the results. ANNOVAR (ANNOtate VARiation) annotation indicated that c.1127 c > T was a deleterious mutation. (2) The review of published papers revealed 68 novel mutations related to HED: 57 (83.8%) were mutations, 8 (11.8%) were mutations, 2 (2.9%) were mutations, 1 (1.5%) was a mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype-phenotype correlation analysis revealed that patients with missense mutations had a higher frequency of hypohidrosis (P = 0.021).

CONCLUSIONS

This study identified two gene mutations in two Chinese Han HED families and provides a foundation for genetic diagnosis and counseling.