Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.