Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast.

The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA. Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae. The 5' and 3' terminal structures of all these sequences are highly constant.