Messenger ribonucleic acid of the lipoprotein of the Escherichia coli outer membrane. I. Nucleotide sequence at the 3' terminus and sequences of oligonucleotides derived from complete digests of the mRNA.

The sequence of 92 nucleotides at the 3' end of the mRNA which codes for the lipoprotein of the outer membrane of Escherichia coli has been determined to be GCUAACCAGCGUCUGGACAACAUGGCUACUAAAUACCGCAAGUAAUAGUACCUGUGAAGUGAAAAAUGGCGCACAUUGUGCGCCAUUUUUUUOH. This sequence includes the 50 nucleotides comprising the 3' untranslated region of the mRNA and contains codons for 14 amino acids at the COOH-terminal of the lipoprotein. In addition, the nucleotide sequences of all oligonucleotides derived from complete ribonuclease T1 and ribonuclease A digestions of the lipoprotein mRNA were established. These oligonucleotides were assigned to portions of the known amino acid sequence as well as the 5' untranslated and 3' untranslated regions of the mRNA molecule. With the use of the genetic code, these oligonucleotide sequences served to establish 94% of the mRNA sequence. The lipoprotein mRNA can be deduced to be 322 nucleotides in length. All three translation termination codons (UAA, UAG, and UGA) were found in phase with the coding region of the mRNA. The region at the 3' end of the mRNA showed unusual resistance to partial degradation, and the partial fragments from this region had anomalous mobilities in two-dimensional gels, even under denaturing conditions. This indicates that there is a very stable hairpin stem-and-loop structure at the 3' end. This hairpin structure exhibits all the structural elements implicated in termination of transcription in, prokaryotes.