[Quantitative characteristics of modifying nucleic acids by alkylating oligonucleotide derivatives in the presence of oligonucleotide effectors].

Modification of the 26-meric DNA fragment d(TTGCCTTGAATGGGAAGAGGGTCATT) with 4-(N-2-chloroethyl-N-methylamino)benzyl-5'-phosphamide derivative of hexadeoxyribonucleotide d(pTTCCCA) was investigated in the presence of two bis-3',5-N-(2-hydroxyethyl)phenazinium derivatives of octadeoxyribonucleotides (effectors E1 and E2) forming complementary complexes with the target next to 3'- and 5'-ends of the reagent's recognition site, respectively. In the absence of effectors, G17 is predominantly modified. Some minor modification of G12, G13 and G14 was also observed. The association constant of the target with the reagent was calculated using the dependence of the modification extent on the initial concentration of the reagent and was found to be Kx = (2.16 +/- 0.38) x 10(4) M-1 at 25 degrees C. At the reagent concentration 5 x 10(-6) M the target modification was nearly absent. In the presence of E1 the modification extent of the 26-mer increased with its concentration to a plateau value of approximately 0.5. Quantitative treatment of this concentration dependence permitted to estimate the value of the product Ke1 alpha = (3.95 +/- 0.43) x 10(8) M-1, where alpha 1 is the cooperativity coefficient and Ke1 is the association constant of the target with E1. To determine alpha 1, the Ke1 value was measured by the gel retardation method and found to be (5.06 +/- 0.23) x 10(7) M-1. Consequently, alpha 1 approximately 8. Effector E2 is less efficient and permits to reach the plateau value only as low as 0.24. This may be due to the competition of the reagent and E2 for the reagent recognition site, since the latter is partially complementary to this site. The increase of the E2 concentration results in a decrease of the modification extent of G17 accompanied with an increase of the modification extent of G12-G14. Thus, in the conditions used the oligonucleotide effectors although increasing the duplex stability do not permit to achieve quantitative yields as it should be for reactions proceeding in quasi-equilibrium conditions.