Isolation of two E-box binding factors that interact with the rat tyrosine hydroxylase enhancer.

The enhancer of the rat tyrosine hydroxylase gene (TH) in PC8b cells is composed of the AP1 motif (TCATTCA, -205 to -199) and an overlapping 20-base pair dyad symmetry element (TCAGAGGCAGGTGCCTGTGA, -201 to -182) whose core is an E-box. We have isolated two partial cDNA clones that encode factors which bind the TH-dyad. One is rITF2 with a basic helix-loop-helix motif and the other is CDP2 with a homeodomain. rITF2 is a rat homolog of human ITF2 (or E2-2), and CDP2 is a member of a new family of homeoproteins defined by histidine as the 9th residue of the recognition helix and by unique 64 amino acid repeats related to those of the Drosophila cut gene. The binding affinity of CDP2 alone is relatively weak, but it enhances the binding of rITF2 to the TH-dyad. In transfected F9 cells, activation of a TH-driven reporter requires both rITF2 and CDP2, suggesting that the proteins may functionally interact. However, rITF2 and CDP2 are not restricted to TH-expressing tissues; hence they may not be involved in the tissue-specific expression of TH. In addition, CDP2 is phosphorylated in vitro and in vivo.