The solution conformations of a mutant trp operator determined by n.m.r. spectroscopy.

The principal conformational features of the mutant trp operator [d(CGTACTGATTAATCAGTACG)2] have been determined by n.m.r. at different temperatures. The sugar puckers were determined from J-resolved spectroscopy and high-resolution homonuclear Hartmann-Hahn spectroscopic (HOHAHA) experiments. Extensive one-dimensional nuclear-Overhauser-enhancement (NOE) data sets were acquired at 25 degrees C using irradiation times of 50, 100, 200, 300 and 500 ms to generate sufficient NOE information to determine the individual nucleotide conformations, and place limits on the local helical parameters, using multi-spin least-squares fitting and searching in conformation space with the program NUCFIT [Lane (1990) Biochim. Biophys. Acta 1049, 189-204]. The conformations of the nucleotides are well determined, and show significant sequence-dependent variation. Pyrimidine residues on average have a wider range of sugar conformations and smaller glycosidic torsion angles than purine residues. The helical parameters are in general less well determined, though clear evidence was obtained for sequence-dependent variation of the helical twist. The overall mean fractional deviation of the calculated from the observed NOEs was 0.108. The conformations of the base-pairs TAAT are temperature-dependent [Lane (1989) Biochem. J. 259, 715-724]. NOESY spectra were recorded at 10, 25 and 40 degrees C, using mixing times inversely proportional to the overall tumbling time to allow changes in the conformation to be described. A more detailed analysis was made using one-dimensional NOEs collected for nucleotides involved in the conformational transitions. There are significant temperature-dependent changes in the conformations of the central base-pairs from T9 to T13 with the largest changes in the glycosidic torsion angle occurring for A11 and A12 (up to 30 degrees). The orientation of the base-pairs T9-A12:T10-A11 also changes, with an increase in the base-pair roll and an unwinding of the helix as the temperature is increased. The conformational changes are qualitatively similar to those observed in a related sequence (Lefèvre, Lane & Jardetzky (1988) Biochemistry 27, 1086-1094]. The conformation is also similar to the wild-type sequence and to that observed in the crystal state in the complex with the trp holorepressor. The similarity suggests that the mutation produces a poorer operator by virtue of removal of essential functional groups within the major groove.