Control of the lux regulon of Vibrio fischeri.

Regulation of expression of bioluminescence from the Vibrio fischeri lux regulon in Escherichia coli is a consequence of a unique form of positive feedback superimposed on a poorly defined cis-acting repression mechanism. The lux regulon consists of two divergently transcribed operons. The leftward operon contains only a single gene, luxR, which encodes a transcriptional activator protein. The rightward operon contains luxI, which together with luxR and the 218 base pairs separating the two operons comprises the primary regulatory circuit, and the five structural genes, luxC, luxD, luxA, luxB and luxE, which are required for the bioluminescence activity. Transcription of luxR from PL is stimulated by binding of the E. coli crp gene product to the sequence TGTGACAAAAATCCAA upstream of the presumed promoter. Binding of pure E. coli CAP protein in a cAMP-dependent reaction to the V. fischeri lux regulatory region has been demonstrated by in vitro footprinting. The luxI gene product is an enzyme which catalyses a condensation reaction of cytoplasmic substrates to yield the autoinducer, N-(3-oxo-hexanoyl) homoserine lactone. Accumulation of autoinducer, which is freely diffusible, results in formation of a complex with LuxR. The complex binds to the sequence ACCTGTAGGATCGTACAGGT upstream of PR to stimulate transcription of the rightward operon. Increased transcription from PR should yield increased levels of LuxI and higher levels of autoinducer which would further activate LuxR. The LuxR binding site is also a LexA binding site, as demonstrated by in vitro footprinting. Basal transcription from both PL and PR is repressed by sequences within the luxR coding region.(ABSTRACT TRUNCATED AT 250 WORDS)