First Report of Soybean vein necrosis-associated virus in Ohio Soybean Fields.

Soybean vein necrosis-associated virus (SVNaV), a newly discovered tospovirus that infects soybean, was first described as widespread in a number of southern and midwestern states, but so far has not been reported in Ohio (1). Here we describe its occurrence in six different soybean leaf samples collected from five Ohio counties: Champaign, Hardin, Sandusky, Seneca, and Wyandot. Specifically, SVNaV was initially identified through a comprehensive survey during the summer of 2011 that used high throughput sequencing to detect genome sequences of viruses present in a pool of 110 field samples collected from 24 Ohio counties. Three assembled contigs, with sizes of 7,551, 4,937, and 1,554 nucleotides (nt) respectively, share 99% nt identity with the three SVNaV genomic RNAs (L, M, and S), and thus constitute partial sequences of the SVNaV Ohio (OH) isolate. The distribution of this virus was further delineated using reverse transcription (RT)-PCR with primers SVNaV-1734F (5' CCATCTTTCTTTCCAGGCATTTCA 3') and SVNaV-S-2421R (5' GATTCAAGTTCAGCGAGTTCTACAA 3'). All plants from which the SVNaV-positive samples were collected showed typical virus symptoms, including systemic mosaic accompanied by leaf deformation, chlorosis, vein necrosis, and rusty spots on mature leaves. These symptoms are largely consistent with the previous report by Zhou and colleagues (1). Intriguingly, further analysis with RT-PCR revealed that five out of the six SVNaV-positive samples also contained a second virus, with Bean pod mottle virus found in four of the samples, and Tobacco ringspot virus in the fifth. Since it is not yet possible to initiate SVNaV infection mechanically, it is difficult to determine whether the co-infecting viruses contribute to the disease symptoms and yield losses. It should be noted that SVNaV may have been in Ohio for some time since symptoms similar to those reported by Zhou and colleagues (1) have been observed in soybean fields of this state since at least 2009. Furthermore, while in 2011 these symptoms were observed in only a few fields, as reflected by the detection of SVNaV in six of the 110 samples, the 2012 growing season has seen a big jump of symptomatic plants and fields. The current report confirms its presence with molecular evidence and lays the groundwork for further assessment of its impact on soybean production. Reference: (1) J. Zhou et al. Virus Genes 43:289, 2011.