Single-Molecule MicroRNA Electrochemiluminescence Detection Using Cyclometalated Dinuclear Ir(III) Complex with Synergistic Effect.

The realization of electrochemiluminescence (ECL) detection at the single-molecule level is a longstanding goal of ECL assay that requires a novel ECL probe with significantly enhanced luminescence. Here, the synergistic effect of electrochemiluminescence (ECL) is observed unprecedentedly in a new cyclometalated dinuclear Ir(III) complex [Ir(dfppy)(imiphenH)]PF (·PF, PF = hexafluorophosphate) in which two {Ir(dfppy)} units are bridged by an imiphenH ligand. The ECL intensity from complex ·PF is 4.4 and 28.7 times as high as that of its reference mononuclear complexes and ·PF, respectively. Theoretical calculation reveals that the S to S excitation is a local excitation in ·PF with two electron-coupled Ir(III) centers, which contributes to the enhanced ECL. The synergistic effect of ECL in ·PF can be used to detect microRNA 21 at the single-molecule level (microRNA 21: UAGCUUAUCAGACUGAUGUUGA), with detectable ECL emission from this complex intercalated in DNA/microRNA 21 duplex as low as 90 helix molecules. The finding of the synergistic effect of ECL will not only provide a novel strategy for the modulation of ECL intensity but also enable the detection of microRNA at the single-molecule level.