Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.