Nucleotide sequence and secondary structure analysis of spinach chloroplast 4.5 S RNA.

The nucleotide sequence of the 4.5 S ribosomal RNA from Spinacia oleracea chloroplast has been determined to be HOAGAGAAGGUCACGGCGAGACGAGCCGUUUAUCAUUAC GAUAGGUGUCAAGUGGAAGUGCAGUGAUGUAUGCAGCUGAGGCAUCCUAACAGACCCACAGACUUGAACOH using rapid gel sequencing techniques. This RNA contains 106 nucleotides including an AGA sequence at the 5'-end not found in other chloroplast 4.5 S RNAs and a seven-nucleotide segment absent in the sequences of wheat and maize 4.5 S RNAs. Except for these differences, the sequence of spinach 4.5 S RNA is highly homologous with those of other species. It shows 95% sequence homology to that of tobacco and 78% homology to those of wheat and maize. The secondary structure was probed using limited ribonuclease T1 and nuclease S1 digestions. The results support the 5'-half of the secondary structure model previously proposed for 4.5 S RNA (Machatt, M. A., Ebel, J.-P., and Branlant, C. (1981) Nucleic Acids Res. 9, 1533-1549) but are inconsistent with the rest of that model. An alternative model for spinach 4.5 S RNA is discussed.