On the phylogeny of Phycomyces blakesleeanus. Nucleotide sequence of 5 S ribosomal RNA.

The nucleotide sequence of the major 5 S ribosomal RNA from the lower fungus Phycomyces blakesleeanus has been determined. The sequence is 5' AAUCUACGGCCAUACAGAUAGUAACACACCGGAUCCCGUCUGAUCUCCGCAGUUAAGUCUCUCCUGGUAGCGUCAGUAC UAUGGUGGGGGACCACAUGGGAAUACGCUAUGUCGUAGGUU3'OH. The Phycomyces 5 S RNA sequence has invariant nucleotide positions characteristic of other eukaryotic 5 S RNAs and fits currently proposed secondary structural models. The Phycomyces of 5 S RNA shows relatively low overall sequence homology to the higher fungal (Ascomycetes) 5 S RNAs (56-60%) but shows higher sequence homology to those 5 S RNAs from Tetrahymena thermophila (68%), human KB cells (67%), and Spinacia oleracea (62%). A comparison of individual segments of the RNA also shows that the structure of Phycomyces 5 S RNA has several major differences from structures common to the higher fungi. Positions 2-14 are homologous with those of metazoan and some protozoan 5 S RNAs. At positions 30-45, the RNA sequence is closer to metazoan 5 S RNAs than to the Neurospora of Aspergillus 5 S RNAs. The Phycomyces 5 S RNA shares similar sequences with both Aspergillus and Tetrahymena 5 S RNAs at positions 79-99. Several other important homologies in primary and proposed secondary structures also have been observed in comparing Phycomyces 5 S RNA with animal and plant 5 S RNAs. We conclude that Phycomyces may not be as closely related phylogenetically to the Ascomycetes as previously thought.