Discrimination of respiratory syncytial virus subgroups A and B by reverse transcription-PCR.

Reverse transcription (RT)-PCR with shared primers differentiating respiratory syncytial virus (RSV) subgroups A and B was developed for subtyping of RSV isolates. Results of RT-PCR were compared with those of an indirect immunofluorescence test using monoclonal antibodies. Viral RNA isolated from cell cultures infected with RSV served as a template for cDNA synthesis with random primers. For PCR, we used three synthetic oligonucleotides corresponding to the G protein mRNA sequence of subgroup A (bases 248 to 267; 3'ATGCAACAAGCCAGATCAAG), subgroup B (bases 314 to 333; 3'ACTCATCCAAACAACCCACA), or both (bases 511 to 530; 3'GGWACAAARTTGAACACTTC). PCR products of RSV subgroups A and B had molecular sizes of 283 and 217 bp, respectively. Specific cutting sites for RSV A and B in amplified cDNA were demonstrated by restriction fragment analysis with four restriction endonucleases. Our RT-PCR assay divided 68 RSV isolates into 47 strains of subgroup A and 21 strains of subgroup B in full agreement with subtyping by monoclonal antibodies. RT-PCR seems to be a good alternative to subtyping of RSV with monoclonal antibodies.