A description of conformational transitions in the Pribnow box of the trp promoter of Escherichia coli.

Selective changes in the NMR parameters of the sequence of CGTACTAGTTAACTAGTACG, which corresponds to the trp operator of Escherichia coli, were observed as a function of temperature. The changes were localized to the sequence TTAA in the Pribnow box (underlined). Differential changes in chemical shift were analyzed in terms of a three-state model (states I, II, and III) to give the equilibrium constants, enthalpy changes, and populations. The midpoints of the first and second transitions were 9 and 30 degrees C, with enthalpy changes of 58 and 35 kcal/mol, respectively. Measurement of the spin-lattice and cross-relaxation rate constants at different temperatures allowed some structural conclusions to be drawn about the nature of the transitions. The line width of the H2 of A11 goes through a maximum at about 30 degrees C, indicating moderately fast exchange between the states. The rate constants for exchange at the midpoints were about 200 (I----II) and 250 (II----III) s-1. Taking these findings into account, we propose a mechanism for the interaction between RNA polymerase and the promoter. This mechanism can explain the temperature dependence observed for the initiation of transcription.