Nucleotide sequence of 5' terminus of alfalfa mosaic virus RNA 4 leading into coat protein cistron.

The sequence of the 5'-terminal 74 nucleotides of alfalfa mosaic virus RNA 4, the mRNA for the viral coat protein, has been deduced by using various new techniques for labeling the RNA at the 5' end with 32P and for sequencing the 5'-32P-labeled RNA. The sequence is NpppGUUUUUAUUUUUAAUUUUCUUUCAAAUACUUCCAUCAUGAGUUCUUCACAAAAGAAAGCUGGUGGGAAAGCUGG. The AUG initiator codon is located 36 nucleotides in from the 5' end; the nucleotide sequence beyond corresponds to the amino acid sequence of the coat protein. This 5' noncoding region is rich in U (58% U); except for the 5'-terminal G, the next G in is part of the initiator AUG codon.