First Report of Bacterial Leaf Spot of Coriander Caused by Pseudomonas syringae pv. coriandricola in India.

A new disease was observed during the early spring of 2011 and 2012 on coriander (Coriandrum sativum L.) in the Himachal Pradesh state of India. Disease incidence was estimated as 10% in approximately 5 ha. Symptoms were observed as brown leaf spots (1 to 2 × 3 to 5 mm) surrounded by a water soaked area. The leaf spots were often angular, being limited by veins. Leaf spots merged to cause a more extensive blight. Symptomatic leaf tissues were surface sterilized in 0.1% HgCl for 30 sec followed by three successive rinses in sterilized water. Small sections of tissue were excised aseptically from leaf spot margins and transferred to several drops of sterile distilled water in a petri dish for 30 min. The diffusate was streaked onto King's B medium and incubated at 25°C for 24 to 48 h. Six representative strains of bacteria were isolated from five infected leaves. The bacteria were characterized as Gram negative, rod shaped, with few polar flagella and nonfluorescent on KB, and positive for levan production and tobacco hypersensitivity reaction but negative for oxidase reaction, rot of potato slices, and arginine dihydrolase. Preliminary identification of bacterial isolates was made on the basis of morphological and biochemical characters (3) and confirmed for one isolate by partial 16S rRNA gene sequencing. Using primers PF:5'AACTGAAGAGTTTGATCCTGGCTC3' and PR:5'TACGGTTACCTTGTTACGACTT3', a 1,265-bp DNA fragment of the 16S rDNA region was amplified. A BLAST search of this sequence (JX 156334) in the NCBI database placed the isolate in the genus Pseudomonas, with 99% similarity to accession P. syringae GRFHYTP52 (GQ160904). The sequence also showed 97% similarity to P. syringae pv. apii and P. syringae pv. coriandricola isolates from California (1). Identification of the bacterium to pathovar was based on host symptoms, fulfillment of Koch's postulates, cultural characteristics, physiological and determinative tests, and specificity of host range (2). Host range studies were conducted on celery, carrot, fennel, parsley, and parsnip, and no symptoms developed on any of these hosts. Pathogenicity was confirmed by artificial inoculation of five 1-month-old coriander plants with all isolates. A bacterial suspension (10 CFU ml) was injected into four leaves for each isolate with a hypodermic syringe and inoculated plants were placed in growth chamber at 25°C and 80% relative humidity. Initial symptoms were observed on leaves within 5 days of inoculation. No symptoms were observed on control plants inoculated with sterile water. Reisolation was performed on dark brown lesions surrounded by yellow haloes on the inoculated leaves and the identity of isolated bacteria was confirmed using the biochemical, pathogenicity, and molecular techniques stated above. All tests were performed three times. To our knowledge, this is the first report of P. syringae pv. coriandricola causing leaf spot disease on coriander in India. References: (1) Bull et al., Phytopathology 101:847, 2011. (2) Cerkauskas, Can. J. Plant Pathol. 31:16, 2009. (3) R. A. Lelliott and D. E. Stead, Methods for the Diagnosis of Bacterial Diseases of Plants, Blackwell Scientific, Sussex, UK, 1988.