First Report of Cucurbit yellow stunting disorder virus in Cucurbits in Florida.

In August and September 2007, watermelon plants (Citrullus lanatus L.) in commercial fields in Manatee and Hillsborough counties in Florida exhibited stunting, deformation, interveinal chlorosis, and leaf mottling. Adult and immature whiteflies (Bemisia tabaci biotype B) were observed. Leaf samples were collected from seven watermelon and two squash plants showing different combinations of symptoms. Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Valencia, CA) and subjected to reverse transcription (RT)-PCR for the presence of criniviruses using primers specific to regions of the Cucurbit yellow stunting disorder virus (CYSDV) genome encoding the coat protein (CysCP5206F 5' TTTGGAAAAGAACCTGACGAG 3'; CysCP5600R 5' TTCATCAACAGATTGGCTGC 3') and HSP70h genes (2). Total nucleic acids were extracted using Gentra Puregene Kit (Qiagen) and subjected to PCR for the presence of begomoviruses using the degenerate primer pairs AC1048 and AV494, designed to amplify a region of the begomovirus coat protein gene (4), and PBL1v2040 and PCRc154, designed to amplify a region of the hypervariable region of the begomovirus B component (3). RT-PCR amplified the expected 394-bp fragment of the coat protein gene from three symptomatic plants (one squash, two watermelon) and from CYSDV-infected control plants but not from healthy controls. Similarly, the 175-bp HSP70h fragment was amplified from the same samples and from CYSDV-infected control plants but not from healthy controls. The coat protein amplicon was sequenced from one of the Manatee County isolates (GenBank Accession No. EU596528) and the 344 nt sequenced portion of the amplicon was found to be 100% identical to sequences of CYSDV from Texas, California, Jordan, and France (GenBank Accession Nos. AF312823, EU596529, DQ903107, and AY204220, respectively) and shared 99% identity with an isolate from Spain (GenBank Accession No. NC_004810), but only 91% with an isolate from Iran (GenBank Accession No. AY730779). The begomovirus primer pair pBL1v2040 and PCRc154 produced a 678-bp amplicon that is consistent with the presence of a bipartite begomovirus in all nine samples. Sequence analysis of four of the 678-bp amplicons revealed that all had greater than 97% sequence identity to isolates of Cucurbit leaf crumple virus (CuLCrV) from Arizona (GenBank Accession No. AF327559) and California (GenBank Accession No. AF224761). These results are similar to those reported in the first detection of CuLCrV in Florida in 2006 (1). In October 2007, CYSDV was detected in squash plants (Cucurbita pepo L.) in two additional fields in Manatee and Hillsborough counties, and additional fields with CYSDV-like symptoms have been observed with increasing frequency throughout the region. The appearance of CYSDV in Florida follows the recent emergence of CYSDV in California and Arizona and Sonora, Mexico in 2006 where the CYSDV infection of fall melons resulted in severe economic losses (2). The emergence of CYSDV in Florida, where the vector B. tabaci biotype B is well established, warrants concern for all cucurbit production in the southern United States. Disease monitoring efforts are in progress to determine the extent, severity, and impact of CYSDV on Florida cucurbit production. References: (1) F. Akad et al. Plant Dis.92:648, 2008. (2) Y.-W. Kuo et al. Plant Dis. 91:330, 2007. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.