alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses.